Skip to content


  • Research
  • Open Access

Human lung myofibroblast TGFβ1-dependent Smad2/3 signalling is Ca2+-dependent and regulated by KCa3.1 K+ channels

  • 1Email author,
  • 2,
  • 3,
  • 1 and
  • 1
Fibrogenesis & Tissue Repair20158:5

  • Received: 10 December 2014
  • Accepted: 5 March 2015
  • Published:



Idiopathic pulmonary fibrosis (IPF) is a common and invariably lethal interstitial lung disease with poorly effective therapy. Blockade of the K+ channel KCa3.1 reduces constitutive α-SMA and Smad2/3 nuclear translocation in IPF-derived human lung myofibroblasts (HLMFs), and inhibits several transforming growth factor beta 1 (TGFβ1)-dependent cell processes. We hypothesized that KCa3.1-dependent cell processes also regulate the TGFβ1-dependent Smad2/3 signalling pathway in HLMFs. HLMFs obtained from non-fibrotic controls (NFC) and IPF lungs were grown in vitro and examined for αSMA expression by immunofluorescence, RT-PCR, and flow cytometry. Two specific and distinct KCa3.1 blockers (TRAM-34 200 nM and ICA-17043 [Senicapoc] 100 nM) were used to determine their effects on TGFβ1-dependent signalling. Expression of phosphorylated and total Smad2/3 following TGFβ1 stimulation was determined by Western blot and Smad2/3 nuclear translocation by immunofluorescence.


KCa3.1 block attenuated TGFβ1-dependent Smad2/3 phosphorylation and nuclear translocation, and this was mimicked by lowering the extracellular Ca2+ concentration. KCa3.1 block also inhibited Smad2/3-dependent gene transcription (αSMA, collagen type I), inhibited KCa3.1 mRNA expression, and attenuated TGFβ1-dependent αSMA protein expression.


KCa3.1 activity regulates TGFβ1-dependent effects in NFC- and IPF-derived primary HLMFs through the regulation of the TGFβ1/Smad signalling pathway, with promotion of downstream gene transcription and protein expression. KCa3.1 blockers may offer a novel approach to treating IPF.


  • Human lung myofibroblast
  • Idiopathic pulmonary fibrosis
  • Potassium channel KCa3.1


Idiopathic pulmonary fibrosis (IPF) is a common disease that occurs primarily in older people with a prevalence in the USA of 227 cases per 100,000 in the >75 year age group [1,2]. In the UK, its incidence doubled between 1998 and 2003 with 4,000 new cases per year, and the incidence continues to increase by 10% annually [2,3]. It therefore represents an important cause of morbidity and mortality, and current treatments such as pirfenidone are of limited efficacy [4-6].

Myofibroblasts are an attractive target for the treatment of IPF. They are the primary effector of tissue fibrosis as they synthesize large quantities of collagen [1], have a contractile phenotype [7-9] and are resistant to apoptosis [10]. Myofibroblast expansion occurs through the differentiation of fibroblasts [11]; this involves reorganization of the actin cytoskeleton, increased expression of alpha smooth muscle actin (αSMA) and incorporation of actin stress fibers [8]. As myofibroblasts rarely persist in healthy lungs, their differentiation is considered a key event in the pathogenesis of IPF.

Transforming growth factor beta 1 (TGFβ1) is a key pro-fibrotic growth factor involved in the pathogenesis of IPF [12-14], which stimulates fibroblast to myofibroblast differentiation both in vivo and in vitro [15-18]. The major TGFβ1-dependent signalling pathway involves the cytoplasmic Smad proteins [19]. Activated TGFβ1 binds to the TGFβ type II receptor (TGFβRII) leading to the recruitment of the TGFβ type I receptor, which induces the phosphorylation of the downstream targets Smad2 and Smad3. Phosphorylated Smad2 and Smad3 then form hetero-oligomeric complexes with Smad4 and translocate to the nucleus to regulate gene expression through transcription and thus mediate the biological effects of TGFβ1 such as cell growth, differentiation and contraction [20-22]. In particular, this TGFβ1/Smad pathway contributes to myofibroblast differentiation by increasing α-smooth muscle actin expression [20,21].

Ion channels are attractive therapeutic targets in many chronic diseases. In particular, the Ca2+ activated K+ channel KCa3.1 plays an important role in Ca2+ signalling through its ability to maintain a negative membrane potential during cellular activation, which enhances Ca2+ influx from the extracellular fluid [23-25]. The KCa3.1 channel modulates the activity of several structural and inflammatory cells [26-28], but more specifically, KCa3.1 blockade inhibits several TGFβ1-dependent cell processes in primary human lung myofibroblasts (HLMFs) derived from both non-fibrotic and IPF lung tissue [29]. Our previous work demonstrated that blocking KCa3.1 with the selective KCa3.1 blockers TRAM-34 and ICA-17043 inhibits TGFβ1-dependent HLMF wound healing, collagen secretion, contraction and Ca2+ influx [29]. In addition, IPF-derived HLMFs demonstrate increased constitutive αSMA expression and Smad2/3 nuclear localisation, effects which are reversed by KCa3.1 inhibition [30].

We hypothesized that KCa3.1 channel activity also regulates TGFβ1-dependent responses in HLMFs through the TGFβ1/Smad signalling pathway. We therefore investigated the role of the KCa3.1 channel in TGFβ1-dependent Smad2/3 phosphorylation, Smad2/3 nuclear translocation, gene transcription and αSMA protein expression in HLMFs obtained from both healthy and IPF lung.


TGFβ1-dependent Smad2/3 phosphorylation is attenuated by KCa3.1 blockade

The ability of KCa3.1 blockers to attenuate several TGFβ1-dependent cell processes in HLMFs [29] suggests that KCa3.1 potentially regulates the activity of TGFβ1-dependent transcription factors. Smad2 and Smad3 are implicated as the major factors regulating HLMF differentiation and collagen secretion in response to TGFβ1 [20,21,31]. Phosphorylation is a key initial event in the activation of these Smad proteins. Using Western blot analysis, we therefore investigated the effect of TGFβ1 (10 ng/ml) on the phosphorylation of Smad2/3 and the expression of total Smad2/3 in HLMFs. Phosphorylation of Smad2/3 after TGFβ1 stimulation was examined over a time course of 5 h and peaked at 60 min (Figure 1A). No significant differences in Smad2/3 phosphorylation were seen between non-fibrotic controls (NFC) and IPF data, and data were therefore pooled for statistical analysis here and elsewhere where no disease-related differences were evident. Further experiments were therefore performed after 60-min stimulation with TGFβ1 in the presence or absence of the highly selective KCa3.1 blockers TRAM-34 (Kd 20 nM) [24] and ICA-17043 (Kd 10 nM) [32]. TGFβ1 increased Smad2/3 phosphorylation in both NFC and IPF-derived HLMFs (P = 0.0022, paired t test). This was suppressed by both TRAM-34 and ICA-17043 (P = 0.0117 and P = 0.0144, respectively, one-way ANOVA corrected by Sidaks multiple comparisons test) (Figure 1B, C, D).
Figure 1
Figure 1

Phosphorylation of Smad2/3 is K Ca 3.1 dependent. (A) Phosphorylation of Smad2/3 in HLMFs was most abundant after 60 min of stimulation with TGFβ1 (10 ng/ml) (n = 3). (B) Representative Western blot analysis showing the increased phosphorylation of Smad2/3 after 60 min of stimulation with TGFβ1 (10 ng/ml) and its inhibition by TRAM-34 and ICA-17043. Phosphorylation of Smad2/3 was examined by fold change over total Smad2/3 and normalized to β-actin. TGFβ1-dependent increases in phosphorylated Smad2/3 were inhibited by TRAM-34 200 nM (NFC n = 3 and IPF n = 4) (C) and by ICA-17043 100 nM (NFC n = 3 and IPF n = 3) (D). Results are represented as mean ± SEM *P < 0.05, **P < 0.01 (repeated measures ANOVA corrected by Sidaks multiple comparison test).

TGFβ1-dependent Smad2/3 nuclear translocation is disrupted by KCa3.1 inhibition

Once TGFβ1 has induced phosphorylation of Smad2/3, this complex interacts with Smad4, which acts as a transporter and enters the nucleus to initiate gene transcription. Inhibition of Smad2/3 phosphorylation should therefore also prevent Smad2/3 nuclear translocation. We previously demonstrated using immunofluorescence that total Smad2/3 nuclear staining was significantly greater in IPF-derived HLMFs in comparison to NFC-derived cells [30], a finding also confirmed in this study (P = 0.0365). Here, TGFβ1 significantly increased Smad2/3 nuclear translocation in HLMFs over untreated control cells (P = 0.0025, paired t test) (Figure 2A, B, C, D). No significant differences were found between TGFβ1-stimulated NFC and IPF HLMF responses, and therefore, statistics were performed on pooled data. TRAM-34 (200 nM) or ICA-17043 (100 nM) significantly attenuated the nuclear translocation of Smad2/3 (P = 0.0034 and P = 0.0029, respectively, two-way ANOVA corrected by Sidak’s multiple comparison test). In contrast, the structurally related molecule, TRAM-85, which does not have channel blocking activity, did not inhibit nuclear translocation of Smad2/3 (Figure 2A, B, C, D). Total Smad2/3 was examined in the nuclear fraction and cytoplasmic extract of both NFC and IPF-derived HMFs. Following TGFβ1-stimulation, there was significantly greater amounts of total Smad2/3 located within the nucleus of HLMFs (P < 0.0001); furthermore, after inhibition with ICA-17043 (100 nM), this increase was attenuated (P = 0.0168, Figure 2E). No significant changes were found in the cytoplasmic extract (Figure 2F). Thus, KCa3.1 activity is critical for the TGFβ1-dependent phosphorylation and nuclear translocation of Smad2/3.
Figure 2
Figure 2

Smad2/3 nuclear translocation is inhibited by K Ca 3.1 channel blockade. (A) The ratio of nuclear to whole cell staining of Smad2/3 demonstrates a significant increase in nuclear translocation following TGFβ1 stimulation compared to control. TRAM-34 (200 nM) inhibited TGFβ1-induced Smad2/3 nuclear translocation (NFC n = 4, IPF n = 4) whereas the structurally related molecule TRAM-85 without KCa3.1 blocking properties did not inhibit nuclear translocation. NFC and IPF data were pooled for statistical analysis. (B) Representative fluorescent microscopy images illustrate the increased expression of Smad2/3 following TGFβ1 stimulation and its movement into the nucleus, which was significantly attenuated by TRAM-34 (200 nM). (C) ICA-17043 (100 nM) also significantly attenuated Smad2/3 nuclear translocation, which can be seen visually in (D). (E) Quantification of Western blot analysis confirms that the total Smad2/3 in the nuclear enriched fraction is significantly increased following TGFβ1 stimulation and attenuated by ICA-17043 (100 nM). Results are normalized to TATA Binding Protein (TBP) and representative Western blot analysis images are shown. (F) Similarly, the total Smad2/3 was examined in the cytoplasmic-enriched fraction; however, no changes were found following TGβ1 stimulation or treatment with ICA-17043 (NFC n = 2 and IPF n = 3, data pooled). Results are represented as mean ± SEM ***P < 0.001, **P < 0.01 (two-way ANOVA corrected by Sidaks multiple comparison test), ## P < 0.0001, one sample t test, # P < 0.05, paired t test.

TGFβ1-dependent Smad2/3 phosphorylation and nuclear translocation are Ca2+-dependent

We have shown previously that KCa3.1 channel blockade inhibits a rise in intracellular Ca2+ in HLMFs following TGFβ1 stimulation [29]. This is likely due to plasma membrane depolarization which reduces Ca2+ entry [25,29]. If this is mechanistically important, lowering extracellular Ca2+ should also inhibit TGFβ1-dependent Smad2/3 phosphorylation and nuclear translocation. Myofibroblasts incubated for 1 h in Ca2+-free media phosphorylated significantly less Smad2/3 in the presence of TGFβ1 (10 ng/ml) than those incubated in media containing normal external Ca2+, P = 0.0439 (one-way ANOVA, corrected by Sidaks multiple comparison test) (Figure 3A, B). This was accompanied by reduced TGFβ1-dependent Smad2/3 nuclear translocation in Ca2+-free media, P = 0.0114 (Figure 4A, B). This suggests that the enhancement of Ca2+-influx by KCa3.1 channels is an essential requirement for the efficient TGFβ1-dependent phosphorylation and nuclear translocation of Smad2/3.
Figure 3
Figure 3

TGF 1-dependent Smad2/3 phosphorylation is Ca 2+ dependent. (A) A representative Western blot demonstrating Smad 2/3 phosphorylation when cells are incubated in media either containing Ca2+ or without. (B). Quantification of Western blots showing that the increased phosphorylation of Smad2/3 after 60 min of TGFβ1 exposure (10 ng/ml) is largely dependent on the presence of extracellular Ca2+. Phosphorylation of Smad2/3 was examined by fold change over total Smad2/3 and normalized to β-actin (NFC n = 2, IPF n = 4, data pooled for statistical analysis). HLMFs stimulated for 1 h in Ca2+-free media phosphorylated significantly less Smad2/3 than those incubated in media containing Ca2+. *P < 0.05, ***P < 0.001 results are represented as median (IQR) (one-way ANOVA, corrected by Sidaks multiple comparison test).

Figure 4
Figure 4

TGFβ1-dependent Smad2/3 nuclear translocation is Ca 2+ dependent. (A) The ratio of nuclear to whole cell TGFβ1-induced Smad 2/3 nuclear translocation is significantly attenuated when cells are incubated in media without Ca2+ (NFC n = 3, IPF n = 3, data pooled). (B) Fluorescent microscopy images illustrating the increased nuclear translocation of total Smad2/3 following TGFβ1 stimulation and its movement into the nucleus, which was significantly attenuated in the absence of Ca2+. Results are represented as mean ± SEM *P < 0.001 (repeated measures ANOVA corrected by Sidaks multiple comparison test).

TGFβ1-dependent increases in αSMA, collagen type I and KCa3.1 mRNA are inhibited following KCa3.1 channel block

Impaired TGFβ1-dependent Smad2/3 nuclear translocation with KCa3.1 blockade predicts that TGFβ1-dependent gene transcription will also be inhibited. To assess this, we first undertook quantitative RT-PCR to examine the mRNA expression of αSMA and collagen type I in HLMFs. TGFβ1 (10 ng/ml) stimulation for 24 h upregulated both αSMA and collagen type I mRNA expression, and these increases were significantly inhibited by both TRAM-34 (200 nM) and ICA-17043 (100 nM) (Figure 5A, B).
Figure 5
Figure 5

TGFβ1-dependent transcription of αSMA, collagen type I and K Ca 3.1 is K Ca 3.1 dependent. (A) TGFβ1 stimulation significantly increased αSMA and collagen I mRNA expression in HLMFs per 103 copies of β-Actin, which was significantly inhibited by TRAM-34 200 nM (NFC n = 4, IPF n = 4, data pooled for statistical analysis). (B) Similarly, ICA-17043 (100 nM) also significantly decreased TGFβ1-dependent increases in αSMA and collagen I mRNA expression in HLMFs (NFC n = 3, IPF n = 3, data pooled). Results are represented as mean ± SEM or median (IQR) ***P < 0.001 (one sample t test), # P < 0.05 and ## P < 0.01 (paired t test or Wilcoxon signed rank test). (C, D) The fold change of TGFβ1-dependent KCa3.1 mRNA expression was significantly higher in IPF HLMFs compared to that in NFC HLMFs, # P = 0.0313 (NFC n = 4, IPF n = 4, data pooled for statistical analysis). This TGFβ1 dependent increase in KCa3.1 mRNA in IPF donors was significantly attenuated by KCa3.1 channel blockers, TRAM-34 and ICA-17043 (*P = 0.0385 and P = 0.0313, respectively, paired t test).

KCa3.1 mRNA and functional channel expression are also upregulated in HLMFs by TGFβ1 [29]. We were therefore interested in whether KCa3.1 regulates its own mRNA expression. We found that TGFβ1 also significantly increased KCa3.1 mRNA expression within HLMFs, and this upregulation was significantly higher in IPF HLMFs in comparison to NFC HLMFs, as previously published [29]. This increase was also inhibited by the KCa3.1 channel blockers TRAM-34, and ICA-17043 (P = 0.0385 and P = 0.0313, respectively, Wilcoxon-matched pairs rank test) (Figure 5C, D). Thus, KCa3.1 channel block inhibited the transcription of several diverse TGFβ1-regulated genes (αSMA - structural protein, collagen type I - secreted matrix protein, KCa3.1 - ion channel), in keeping with its ability to inhibit Smad2/3 phosphorylation and nuclear translocation.

KCa3.1 block attenuates TGFβ1-induced increases in αSMA protein expression

We and others have shown previously that IPF-derived HLMFs express higher levels of αSMA than NFC HLMFs constitutively, and we showed that this is inhibited by KCa3.1 blockade. Because TGFβ1-dependent transcription of the αSMA gene is also inhibited by KCa3.1 blockers, we proceeded to investigate the effect of KCa3.1 blockers on TGFβ1-dependent αSMA protein expression in HLMFs.

Flow cytometry was used to examine αSMA expression in HLMFs following 24 h of TGFβ1-stimulation in the presence of KCa3.1 channel blockers. TGFβ1 significantly increased αSMA protein expression in both NFC- and IPF-derived myofibroblasts (P = 0.0156, Wilcoxon signed rank test). TRAM-34 (20 and 200 nM) and ICA-17043 (10 and 100 nM) both dose-dependently decreased TGFβ1-dependent αSMA expression when examined by the fold change in geometric mean fluorescent intensity, P = 0.0052 and P = 0.0278, respectively (one-way ANOVA) (Figure 6A, B, C). This indicates a phenotypic transition of HLMFs into a more fibroblast-like phenotype, which would explain the reduced contraction, secretion and proliferative abilities demonstrated in previously published work [29].
Figure 6
Figure 6

TGFβ1-dependent αSMA protein expression is attenuated by K Ca 3.1 channel block. (A) Flow cytometry measurements of αSMA expression in HLMFs show that the fold change in gMFI was significantly increased by TGFβ1 (10 ng/ml) (NFC n = 3, IPF n = 4, data pooled for statistical analysis). TRAM-34 (20 and 200nM) dose-dependently decreased TGFβ1-induced αSMA expression. (B) Similarly, ICA-17043 (10 and 100nM) significantly reduced TGFβ1-induced αSMA expression. (C) Representative fluorescent histogram showing αSMA expression in HLMFs under the above conditions. Results are represented as mean ± SEM. # P < 0.05 (paired t test); *P < 0.05, **P < 0.01 (corrected by Dunn’s multiple comparisons test).


This study demonstrates that Ca2+ and the Ca2+-activated K+ channel KCa3.1 play a key role in the TGFβ1-dependent activation of Smad2/3 in HLMFs. Inhibition of KCa3.1 channels therefore attenuates TGFβ1-dependent gene transcription, resulting in the inhibition of pro-fibrotic HLMF activity [30] and de-differentiation of HLMFs towards a fibroblast phenotype as indicated by a reduction in αSMA protein.

This paper provides mechanistic insight into the inhibitory effects of KCa3.1 blockers on HLMF pro-fibrotic function. Open K+ channels hyperpolarize the plasma membrane and increase Ca2+ entry following receptor-dependent cell activation [29,33]. We have demonstrated previously that blocking KCa3.1 channels reduces constitutive αSMA expression and Smad2/3 nuclear localization in NFC- and IPF-derived HLMFs, although it was not possible to detect Smad2/3 phosphorylation under these conditions [30]. We have also shown previously that KCa3.1 activity is required for a rise in intracellular Ca2+ that occurs following exposure of HLMFs to TGFβ1 [29]. Importantly, here, we have shown that extracellular Ca2+ and KCa3.1 activity are required for the TGFβ1-dependent phosphorylation and nuclear translocation of Smad2/3, an essential initial step in Smad2/3 activation. Thus, there is a clear mechanistic link between KCa3.1 activity and Smad2/3-dependent cell signalling. Although other signalling cascades including ras/MEK/ERK and P38 MAPK are also involved in TGFβ1 pro-fibrotic signalling, our data nevertheless suggest that the predominant regulation of the TGFβ1 signalling pathway by KCa3.1 channels occurs proximally at or above the level of Smad2/3 phosphorylation, via effects on Ca2+ signalling.

This study both supports and extends the work of others investigating the role of KCa3.1 in renal fibrosis [34], liver fibrosis [35] and brain pathology [36]. Murine renal fibroblast proliferation and kidney fibrosis following ureteric obstruction were significantly attenuated by KCa3.1 blockers [37], while in a streptazocin mouse model of diabetes-induced renal fibrosis, KCa3.1 inhibition reduced TGFβ1, TGFBRII and phosphoSmad2/3 expression in the tissue [34,38]. Subsequent work from the same authors using human renal interstitial fibroblasts showed that TGFβ1-dependent increases in types I and IV collagen and αSMA mRNA expression were attenuated by KCa3.1 blockade, although there was only a reduction in type IV collagen protein expression reported [34]. In contrast, we found clear evidence of reduced collagen type I mRNA expression in keeping with previous observations that KCa3.1 blockade attenuates TGFβ1-dependent HLMF collagen secretion [29] and that fibroblasts lacking the Smad3 gene have reduced induction of collagen type I gene [39]. We also found that TGFβ1-dependent αSMA gene transcription was inhibited by KCa3.1 blockers, and TGFβ1-dependent HLMF αSMA protein expression were reduced. In keeping with the work of Huang et al., we also found that TGFβ1-dependent phosphorylation of Smad2/3 was attenuated by KCa3.1 blockade [38], but in addition show that this prevents Smad2/3 nuclear translocation.

It is important that we have demonstrated the effects of KCa3.1 inhibition in parenchymal HLMFs because of the functional heterogeneity evident in fibroblasts from different tissues and between species [40-42]. Moreover, in previous studies of renal fibroblasts, the concentration of TRAM-34 (2 μM) used was relatively high [38]. We used two distinct KCa3.1 blockers at the IC50 (20 nM for TRAM-34 and 10 nM for ICA-17043) and at 10× the IC50 where >95% of channels will be blocked and found clear evidence for activity of these drugs at these physiologically relevant concentrations. Importantly, the concentration of ICA-17043 used here can be achieved in vivo with oral dosing [43], although the free drug concentration will be reduced due to protein binding. Thus, pharmacological activity is likely to be achieved within human lung following oral administration.

We found previously that KCa3.1 inhibition reduced TGFβ1-dependent HLMF contractility in collagen gels [29]. Our demonstration that this is associated with reduced αSMA gene transcription and protein expression suggests that de-differentiation towards a fibroblast phenotype with reduced contractile machinery may explain this reduced contractility, at least in part. However, attenuation of Ca2+ influx as demonstrated previously [29], with depolarization of the plasma membrane could also contribute to the effects of KCa3.1 blockade on HLMF contraction.

Our findings also provide a potential mechanism for the ability of KCa3.1 inhibition to prevent airway wall remodelling in a mouse model of asthma [44]. That study demonstrated that treatment with TRAM-34 reduced airway smooth muscle mass, peribronchial fibrosis, and sub-epithelial collagen expression. While these effects might have occurred in part through the inhibition of the associated inflammatory response, it seems likely that a direct effect on airway smooth muscle and myofibroblast activity was also relevant.


Myofibroblast activity is clearly a key driver of tissue fibrosis and shrinkage in IPF [45-47]. There is strong evidence that TGFβ1-dependent signalling contributes to this fibrotic process [12,14,20,30,38,48]. However, there is also evidence that HLMFs derived from IPF lungs also exhibit greater constitutive pro-fibrotic activity, which might occur due to pre-programming by genetics, and/or re-programming by epigenetics [30,49]. Importantly, KCa3.1 blockade is able to inhibit both TGFβ1-dependent and constitutive pro-fibrotic HLMF activity as shown here and in our previous study [30], respectively. This provides further support for the view that KCa3.1 may provide a novel and effective target for the treatment of IPF. Furthermore, the capacity for KCa3.1 inhibition to downregulate TGFβ1-dependent increases in KCa3.1 expression suggests that inhibiting KCa3.1 will rapidly downregulate the TGFβ1 axis through positive feedback (Figure 7). KCa3.1 knockout animals are relatively healthy, and an oral KCa3.1 inhibitor, ICA-17043 (Senicapoc), was well tolerated for 12 months in a phase III clinical trial of sickle cell disease [43]. There is therefore the potential for the rapid translation of KCa3.1-directed therapy to the clinic.
Figure 7
Figure 7

The involvement of K Ca 3.1 in the TGF/Smad 2/3 signalling pathway. A diagrammatic representation of how Smad2/3 phosphorylation and subsequent nuclear translocation is reliant on an influx of extracellular Ca2+ and KCa3.1 ion channels. TGFβ1 stimulation triggers an influx of extracellular Ca2+, which in turns opens Ca2+-activated KCa3.1 K+ channels. KCa3.1 opening maintains a negative membrane which in turn promotes Ca2+ entry. Phosphorylation of Smad2/3 and therefore its downstream effects such as translocation and gene transcription are heavily reliant on Ca2+. KCa3.1 channel inhibition reduces Ca2+ entry, which in turn reduces Smad2/3 phosphorylation and nuclear translocation, and thus reduces TGFβ1-dependent gene transcription.


Ethics statement

All patients donating tissue gave written informed consent, and the study was approved by the National Research Ethics Service (references 07/MRE08/42 and 10/H0402/12).

Human lung myofibroblasts isolation and culture

NFC parenchymal HLMFs were derived from healthy areas of lung from patients undergoing lung resection for carcinoma at Glenfield Hospital, Leicester, UK. No morphological evidence of disease was found in the tissue samples used for HLMF isolation. IPF HLMFs were derived from patients undergoing lung biopsy for diagnostic purposes at the University of Pittsburgh Medical Center, USA, and were shown to have UIP on histological examination. HLMFs were grown from explanted lung tissue from both sources under identical conditions, using Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), antibiotic/antimycotic agents and non-essential amino acids [50,51]. The cells were cultured at 37°C in 5% CO2/95% air. The cells were studied at passages 4 to 5 for functional studies. Myofibroblasts were characterized as previously described [29]. All NFC patients gave informed written consent, and the study was approved by the Leicestershire, Northamptonshire and Rutland Research Ethics Committee 2. Written informed consent was also obtained from all IPF subjects, in accordance with the responsible University of Pittsburgh Institutional Review Board.

Flow cytometry

HLMFs were grown on T25 flasks and serum starved for 24 h prior to the experiment. The HLMFs were either left unstimulated or stimulated for 24 h with TGFβ1 (10 ng/ml), in the presence of 0.1% DMSO control, TRAM-34 (200 nM) or ICA-17043 (100 nM). The cells were detached using 0.1% trypsin/0.1% EDTA, washed then fixed and permeabilized in 4% paraformaldehyde plus 0.1% saponin (Sigma-Aldrich, St. Louis, MO, USA), respectively, for 20 min on ice. Myofibroblasts were labelled with FITC-conjugated mouse monoclonal anti-αSMA (Sigma-Aldrich, St. Louis, MO, USA), indirectly labelled with FITC and isotype control FITC-conjugated mouse IgG2a. Secondary antibodies labelled with FITC (F0313, Dako, Glostrup, Denmark) were applied. Analysis was performed using single colour flow cytometry on a FACScan (BD, Oxford, UK).


HLMF RNA was isolated using the RNeasy Plus Kit (Qiagen, West Sussex, UK) according to the manufacturer’s instructions. Primers were designed for ACT2A, forward TTCAATGTCCCAGCCATGTA and reverse GAAGGAATAGCCACGCTCAG, product size 222 bp from NCB1 Reference sequence NM_001141945.1 and COL1A1, forward TTCTGCAACATGGAGACTGG and reverse CGCCATACTCGAACTGGAATC, product size 151 bp from reference sequence NM_000088.3. KCa3.1 and β-actin primers were analysed using gene-specific Quantitect Primer Assay primers (Qiagen, Hilden, Germany), Hs_KCNN4_1_SG and HS_ACTB_1_SG. All experiments were performed in duplicate. All expression data was normalized to β-actin and corrected using the reference dye ROX. Gene expression was quantified by real-time PCR using the Brilliant SYBR Green QRT-PCR 1-Step Master Mix (Stratagene, Breda, The Netherlands). PCR products were run on a 1.5% agarose gel to confirm the product amplified was the correct size, and they were sequenced to confirm the specificity of the primers. Prior to qRT-PCR, myofibroblasts were grown to confluence, serum starved for 24 h and then stimulated with TGFβ1 (10 ng/ml) in the presence of 0.1% DMSO control, TRAM-34 (200 nM) or ICA-17043 (100 nM).

Western blot for SMAD proteins

Cells were grown in T75 flasks, serum starved for 24 h and stimulated with TGFβ1 (10 ng/ml) in the presence of either 0.1% DMSO control, TRAM-34 (200 nM), ICA-17043 (100 nM) or Ca2+-free media for 1 h. The cells were detached with 0.1% Trypsin/EDTA and washed. The protein was isolated using RIPA buffer lysis system (Santa Cruz, Heidelberg, Germany), and the total protein concentration was determined using the DC Bio-Rad protein Assay (Bio-Rad, Hemel Hempstead, UK). Of the protein, 30 μg was resolved using 10% Mini-Protean TGX precast gels (Bio-Rad, Hemel Hempstead, UK) and then transferred to an immunobilon-P polyvinylidene difluoride membrane, using Trans-blot Turbo transfer packs (Bio-Rad, Hemel, Hemopstead, UK). The membranes were blocked with 5% milk and incubated with rabbit monoclonal anti-phospho-Smad2/Smad3 (0.231 μg/ml, Cell Signalling, Danvers, MA, USA) or rabbit monoclonal anti-smad2/smad3 (0.0087 μg/ml, Cell Signalling). Protein bands were identified by horseradish peroxidase-conjugated secondary antibody and enhanced chemiluminescence reagent (Amersham Laboratories, Buckinghamshire, UK). Immunolabelled proteins were visualized using ImageQuant LAS 4000 (GE Healthcare Life Sciences, Buckinghamshire, UK).

SMAD nuclear translocation

HLMFs were grown on 8-well chamber slides and serum-starved for 24 h prior to the experiment. The cells were then stimulated with TGFβ1 (10 ng/ml) in the presence of either 0.1% DMSO control, TRAM-34 (200 nM), ICA-17043 (100 nM), TRAM-85 (200nM) or Ca2+-free media. After 1 h, the cells were fixed with methanol for 20 min on ice, blocked using 3% BSA for 1 h and immunostained using rabbit monoclonal anti-Smad2/Smad3 (0.174 μg/ml, Cell Signalling). Secondary antibody labelled with FITC (F0313, Dako) was applied, and the cells counterstained with 4′,6-diamidino-2-phenylindole (DAPI, Sigma-Aldrich, St. Louis, MO, USA). The cells were mounted with fluorescent mounting medium and cover-slipped.

Original images were captured on an epifluorescent microscope (Olympus BX50, Olympus UK Ltd., Southend-on-sea, Essex, UK); grey scale intensity was examined using Cell F imaging software (Olympus UK Ltd., Essex, UK). Matched exposures were used for isotype controls. The intensity of nuclear Smad2/3 staining was quantified by measuring the grey scale intensity of DAPI positive nuclei with a minimum of 10 random cells measured in one field for each condition.

Nuclear fraction

NFC and IPF-derived HLMFs were grown in T75 flasks, serum-starved for 24 h then stimulated with TGFβ1 (10 ng/ml) in the presence of either 0.1% DMSO control, TRAM-34 (200 nM) or ICA-17043 (100 nM). After 1 h, HLMF were detached with 0.1% Trypsin/EDTA and washed. Nuclear and cytoplasmic extracts were isolated using the Nuclear Extract Kit (Abcam, ab113474, New territories, Hong Kong). Proteins of both the nuclear and cytoplasmic extracts were then isolated using the RIPA buffer lysis system and the concentration determined using the DC Bio-Rad protein Assay. Western blot was then performed as described above.

Statistical analysis

Experiments from an individual donor were performed either in duplicate or triplicate, and a mean value was derived for each condition. Data distribution across donors was tested for normality using the Kolmogorov-Smirnov test. For parametric data, the one-way ANOVA or repeated measures ANOVA for across-group comparisons was used followed by the appropriate multiple comparison post hoc test; otherwise, an unpaired or paired t test was used. Where appropriate, a one sample t test was used using a null hypothesis of 1. For non-parametric data, the Friedman test was used for across group comparisons followed by the appropriate multiple comparison post hoc test, or the Mann Whitney U test was used where there were two unpaired groups. GraphPad Prism for windows (version 6, GraphPad Software, San Diego, CA, USA) was used for these analyses. A value of P < 0.05 was taken to assume statistical significance and data are represented as mean (± SEM) or median (IQR).



Dulbecco’s modified eagle’s medium


Fetal bovine serum


Human lung myofibroblast


Idiopathic pulmonary fibrosis


Interquartile range


Non-fibrotic control


Standard error of the mean


Transforming growth factor beta 1


Transforming growth factor beta receptor II


α-smooth muscle actin



This work was supported by The Dunhill Medical Trust, project grant R270/1112. The work was also supported in part by the National Institute for Health Research Leicester Respiratory Biomedical Research Unit. The views expressed are those of the author(s) and not necessarily those of the NHS, the NIHR or the Department of Health. HW was supported by RO1 GM076063 from the National Institute of Health. The funders had no role in study design, data collection and analysis, decision to publish or preparation of the manuscript.

Authors’ Affiliations

Department of Infection, Immunity and Inflammation, Institute for Lung Health, University of Leicester, Glenfield Hospital, Groby Road, Leicester, LE3 9QP, UK
Department of Medicine, Division of Rheumatology and Immunology, University of South Carolina, Columbia, SC 29208, USA
Department of Pharmacology, University of California, 451 Health Sciences Drive, Davis, CA 95616, USA


  1. Raghu G, Masta S, Meyers D, Narayanan AS. Collagen synthesis by normal and fibrotic human lung fibroblasts and the effect of transforming growth factor-beta. Am Rev Respir Dis. 1989;140(1):95–100.View ArticlePubMedGoogle Scholar
  2. Raghu G, Weycker D, Edelsberg J, Bradford WZ, Oster G. Incidence and prevalence of idiopathic pulmonary fibrosis. Am J Respir Crit Care Med. 2006;174(7):810–6.View ArticlePubMedGoogle Scholar
  3. Gribbin J, Hubbard RB, Le Jeune I, Smith CJ, West J, Tata LJ. Incidence and mortality of idiopathic pulmonary fibrosis and sarcoidosis in the UK. Thorax. 2006;61(11):980–5.View ArticlePubMed CentralPubMedGoogle Scholar
  4. Noble PW, Albera C, Bradford WZ, Costabel U, Glassberg MK, Kardatzke D, et al. Pirfenidone in patients with idiopathic pulmonary fibrosis (CAPACITY): two randomised trials. Lancet. 2011;377(9779):1760–9.View ArticlePubMedGoogle Scholar
  5. Carter NJ. Pirfenidone in idiopathic pulmonary fibrosis. Drugs. 2011;71(13):1721–32.View ArticlePubMedGoogle Scholar
  6. King TEJ, Bradford WZ, Castro-Bernardini S, Fagan EA, Glaspole I, Glassberg MK, et al. A phase 3 trial of pirfenidone in patients with idiopathic pulmonary fibrosis. N Engl J Med. 2014;370(22):2083–92.View ArticlePubMedGoogle Scholar
  7. Wipff PJ, Rifkin DB, Meister JJ, Hinz B. Myofibroblast contraction activates latent tgf-beta1 from the extracellular matrix. J Cell Biol. 2007;179:1311–23.View ArticlePubMed CentralPubMedGoogle Scholar
  8. Grinnell F. Fibroblasts, myofibroblasts, and wound contraction. J Cell Biol. 1994;124(4):401–4.View ArticlePubMedGoogle Scholar
  9. Gabbiani G, Ryan GB, Majno G. Presence of modified fibroblasts in granulation tissue and their possible role in wound contraction. Experientia. 1971;27:5.View ArticleGoogle Scholar
  10. Zhang HY, Phan SH. Inhibition of myofibroblast apoptosis by transforming growth factor beta(1). Am J Respir Cell Mol Biol. 1999;21:6.View ArticleGoogle Scholar
  11. Sanders YY, Kumbla P, Hagood JS. Enhanced myofibroblastic differentiation and survival in Thy-1(−) lung fibroblasts. Am J Respir Cell Mol Biol. 2007;36(2):226–35.View ArticlePubMed CentralPubMedGoogle Scholar
  12. Branton MH, Kopp JB. TGF-beta and fibrosis. Microbes Infect. 1999;1(15):1349–65.View ArticlePubMedGoogle Scholar
  13. Raghu G, Masta S, Meyers D, Narayanan AS. Collagen synthesis by normal and fibrotic human lung fibroblasts and the effect of transforming growth factor-β. Am J Respir Crit Care Med. 1989;140(1):95–100.Google Scholar
  14. Khalil N, Oconnor R, Unruh H, Warren P, Flanders K, Kemp A, et al. Increased production and immunohistochemical localization of transforming growth-factor-beta in idiopathic pulmonary fibrosis. Am J Respir Cell Mol Biol. 1991;5(2):155–62.View ArticlePubMedGoogle Scholar
  15. Guo W, Shan B, Klingsberg RC, Qin X, Lasky JA. Abrogation of TGF-beta1-induced fibroblast-myofibroblast differentiation by histone deacetylase inhibition. Am J Physiol Lung Cell Mol Physiol. 2009;297(5):L864–70.View ArticlePubMed CentralPubMedGoogle Scholar
  16. Moustakas A, Pardali K, Gaal A, Heldin C. Mechanisms of TGF-β signaling in regulation of cell growth and differentiation. Immunol Lett. 2002;82(1–2):85–91.View ArticlePubMedGoogle Scholar
  17. Khouw IMSL, van Wachem PB, Plantinga JA, Vujaskovic Z, Wissink MJ, de Leij LFMH, et al. TGF-β and bFGF affect the differentiation of proliferating porcine fibroblasts into myofibroblasts in vitro. Biomaterials. 1999;20(19):1815–22.View ArticlePubMedGoogle Scholar
  18. Mattey DL, Dawes PT, Nixon NB, Slater H. Transforming growth factor beta 1 and interleukin 4 induced alpha smooth muscle actin expression and myofibroblast-like differentiation in human synovial fibroblasts in vitro: modulation by basic fibroblast growth factor. Ann Rheum Dis. 1997;56(7):426–31.View ArticlePubMed CentralPubMedGoogle Scholar
  19. Attisano L, Wrana JL. Signal transduction by the TGF-ß superfamily. Science. 2002;296(5573):1646–7.View ArticlePubMedGoogle Scholar
  20. Gu L, Zhu Y, Yang X, Guo Z, Xu W, Tian X. Effect of TGF-beta/Smad signaling pathway on lung myofibroblast differentiation. Acta Pharmacol Sin. 2007;28(3):382–91.View ArticlePubMedGoogle Scholar
  21. Hu B, Wu Z, Phan SH. Smad3 mediates transforming growth factor-beta-induced alpha-smooth muscle actin expression. Am J Respir Cell Mol Biol. 2003;29:3.View ArticleGoogle Scholar
  22. Nakao A, Imamura T, Souchelnytskyi S, Kawabata M, Ishisaki A, Oeda E, et al. TGF-beta receptor-mediated signalling through Smad2, Smad3 and Smad4. EMBO J. 1997;16(17):5353–62.View ArticlePubMed CentralPubMedGoogle Scholar
  23. Fanger C, Rauer H, Neben A, Miller M, Rauer H, Wulff H, et al. Calcium-activated potassium channels sustain calcium signaling in T lymphocytes - selective blockers and manipulated channel expression levels. J Biol Chem. 2001;276(15):12249–56.View ArticlePubMedGoogle Scholar
  24. Wulff H, Miller MJ, Hansel W, Grissmer S, Cahalan MD, Chandy KG. Design of a potent and selective inhibitor of the intermediate-conductance Ca2+-activated K+ channel, IKCa1: a potential immunosuppressant. Proc Natl Acad Sci U S A. 2000;97(14):8151–6.View ArticlePubMed CentralPubMedGoogle Scholar
  25. Duffy S, Berger P, Cruse G, Yang W, Bolton SJ, Bradding P. The K+ channel iKCA1 potentiates Ca2+ influx and degranulation in human lung mast cells. J Allergy Clin Immunol. 2004;114(1):66–72.View ArticleGoogle Scholar
  26. Ghanshani S, Wulff H, Miller MJ, Rohm H, Neben A, Gutman GA, et al. Up-regulation of the IKCa1 potassium channel during T-cell activation. Molecular mechanism and functional consequences. J Biol Chem. 2000;275(47):37137–49.View ArticlePubMedGoogle Scholar
  27. Cruse G, Duffy SM, Brightling CE, Bradding P. Functional KCa3.1 K+ channels are required for human lung mast cell migration. Thorax. 2006;61(10):880–5.View ArticlePubMed CentralPubMedGoogle Scholar
  28. Bradding P, Wulff H. The K+ channels K(Ca)3.1 and K(v)1.3 as novel targets for asthma therapy. Br J Pharmacol. 2009;157(8):1330–9.View ArticlePubMed CentralPubMedGoogle Scholar
  29. Roach K, Duffy S, Coward W, Feghali-Bostwick C, Wulff H, Bradding P. The K+ channel KCa3.1 as a novel target for idiopathic pulmonary fibrosis. PLoS One. 2013;8(12):e85244.View ArticlePubMed CentralPubMedGoogle Scholar
  30. Roach KM, Wulff H, Feghali-Bostwick C, Amrani Y, Bradding P. Increased constitutive αSMA and Smad2/3 expression in idiopathic pulmonary fibrosis myofibroblasts is KCa3.1-dependent. Respir Res. 2014;15:155. doi:10.1186/s12931-014-0155-5.View ArticlePubMed CentralPubMedGoogle Scholar
  31. Zhao J, Shi W, Wang Y, Chen H, Bringas PJ, Datto MB, et al. Smad3 deficiency attenuates bleomycin-induced pulmonary fibrosis in mice. Am J Physiol Lung Cell Mol Physiol. 2002;282(3):585–93.View ArticleGoogle Scholar
  32. Stocker JW, De Franceschi L, McNaughton-Smith GA, Corrocher R, Beuzard Y, Brugnara C. ICA-17043, a novel Gardos channel blocker, prevents sickled red blood cell dehydration in vitro and in vivo in SAD mice. Blood. 2003;101(6):2412–8.View ArticlePubMedGoogle Scholar
  33. Berridge MJ, Lipp P, Bootman MD. The versatility and universality of calcium signalling. Nat Rev Mol Cell Biol. 2000;1(1):11–21.View ArticlePubMedGoogle Scholar
  34. Huang C, Shen S, Ma Q, Gill A, Pollock CA, Chen X. KCa3.1 mediates activation of fibroblasts in diabetic renal interstitial fibrosis. Nephrol Dial Transplant. 2014;29(2):313–24.View ArticlePubMed CentralPubMedGoogle Scholar
  35. Freise C, Heldwein S, Erben U, Hoyer J, Köhler R, Jöhrens K, et al. K+-channel inhibition reduces portal perfusion pressure in fibrotic rats and fibrosis associated characteristics of hepatic stellate cells. Liver Int. 2014;35(4):1244–52.View ArticlePubMedGoogle Scholar
  36. Yu Z, Yu P, Chen H, Geller HM. Targeted inhibition of KCa3.1 attenuates TGF-beta-induced reactive astrogliosis through the Smad2/3 signaling pathway. J Neurochem. 2014;130(1):41–9.View ArticlePubMedGoogle Scholar
  37. Grgic I, Kiss E, Kaistha BP, Busch C, Kloss M, Sautter J, et al. Renal fibrosis is attenuated by targeted disruption of KCa3.1 potassium channels. Proc Natl Acad Sci U S A. 2009;106(34):14518–23.View ArticlePubMed CentralPubMedGoogle Scholar
  38. Huang C, Shen S, Ma Q, Chen J, Gill A, Pollock CA, et al. Blockade of KCa3.1 ameliorates renal fibrosis through the TGF-beta1/Smad pathway in diabetic mice. Diabetes. 2013;62(8):2923–34.View ArticlePubMed CentralPubMedGoogle Scholar
  39. Chen SJ, Yuan WH, Mori Y, Levenson A, Trojanowska M, Varga J. Stimulation of type I collagen transcription in human skin fibroblasts by TGF-beta: involvement of Smad 3. J Invest Dermatol. 1999;112(1):49–57.View ArticlePubMedGoogle Scholar
  40. Kotaru C, Schoonover KJ, Trudeau JB, Huynh ML, Zhou X, Hu H, et al. Regional fibroblast heterogeneity in the lung: implications for remodeling. Am J Respir Crit Care Med. 2006;173(11):1208–15.View ArticlePubMed CentralPubMedGoogle Scholar
  41. Kishaba Y, Matsubara D, Niki T. Heterogeneous expression of nestin in myofibroblasts of various human tissues. Pathol Int. 2010;60(5):378–85.View ArticlePubMedGoogle Scholar
  42. Zhou X, Wu W, Hu H, Milosevic J, Konishi K, Kaminski N, et al. Genomic differences distinguish the myofibroblast phenotype of distal lung from airway fibroblasts. Am J Respir Cell Mol Biol. 2011;45(6):1256–62.View ArticlePubMed CentralPubMedGoogle Scholar
  43. Ataga KI, Smith WR, De Castro LM, Swerdlow P, Saunthararajah Y, Castro O, et al. Efficacy and safety of the Gardos channel blocker, senicapoc (ICA-17043), in patients with sickle cell anemia. Blood. 2008;111(8):3991–7.View ArticlePubMedGoogle Scholar
  44. Girodet P, Ozier A, Carvalho G, Ilina O, Ousova O, Gadeau A, et al. Ca2+-Activated K+ Channel-3.1 Blocker TRAM-34 attenuates airway remodeling and eosinophilia in a murine asthma model. Am J of Respir Cell Mol Biol. 2013;48(2):212–9.View ArticleGoogle Scholar
  45. McAnulty RJ. Fibroblasts and myofibroblasts: their source, function and role in disease. Int J Biochem Cell Biol. 2007;39(4):666–71.View ArticlePubMedGoogle Scholar
  46. Tomasek J, Gabbiani G, Hinz B, Chaponnier C, Brown R. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol. 2002;3(5):349–63.View ArticlePubMedGoogle Scholar
  47. Phan SH. The myofibroblast in pulmonary fibrosis. Chest. 2002;122(6 Suppl):286S–9.View ArticlePubMedGoogle Scholar
  48. Willis BC, Borok Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 2007;293(3):L525–34.View ArticlePubMedGoogle Scholar
  49. Coward WR, Watts K, Feghali-Bostwick CA, Knox A, Pang L. Defective histone acetylation is responsible for the diminished expression of cyclooxygenase 2 in idiopathic pulmonary fibrosis. Mol Cell Biol. 2009;29(15):4325–39.View ArticlePubMed CentralPubMedGoogle Scholar
  50. Keira SM, Ferreira LM, Gragnani A, Duarte IS, Santos A. Anunciação Neves dos I. Experimental model for fibroblast culture. Acta Cir Bras. 2004;19:11–6.Google Scholar
  51. Pilewski JM, Liu LX, Henry AC, Knauer AV, Feghali-Bostwick CA. Insulin-like growth factor binding proteins 3 and 5 are overexpressed in idiopathic pulmonary fibrosis and contribute to extracellular matrix deposition. Am J Pathol. 2005;166(2):399–407.View ArticlePubMed CentralPubMedGoogle Scholar


© Roach et al.; licensee BioMed Central. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.
