Skip to main content

Table 2 Primers used for real-time PCR transcript analysis

From: Differential effects of hyaluronan synthase 3 deficiency after acute vs chronic liver injury in mice

Gene name Protein Gen bank acc # Sequence source Forward primer Reverse primer
Has1 Has1 NM_008215 PrimerBank: 6680169a1 GGCGAGCACTCACGATCATC AGGAGTCCATAGCGATCTGAAG
Has2 Has2 NM_008216 Matrix Biol. 30(2):126–134, 2011 GGTCCAAGTGCCTTACTGAAAC TGTACAGCCACTCTCGGAAGTA
Has3 Has3 NM_008217 PrimerBank: 6680173a1 GTGGGCACCAGTCTGTTTG CCACTGAACGCGACCTCTG
Ccl2 CCL2/MCP1 NM_011333 Immunol. Cell Biol. 89:716, 2011 AGGTCCCTGTCATGCTTCTG TCTGGACCCATTCCTTCTTG
Cxcl1 CXCL1/GRO1/KC NM_008176 PrimerBank: 229577225c1 ACTGCACCCAAACCGAAGTC TGGGGACACCTTTTAGCATCTT
Cxcl10 CXCL10/IP10 NM_021274 PrimerBank: 10946576a1 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAA
Cd11b CD11b NM_001082960 PrimerBank: 132626288c3 GGGAGGACAAAAACTGCCTCA ACAACTAGGATCTTCGCAGCAT
Tgfb1 TGFβ1 NM_011577 PrimerBank: 6755774b1 AGCTGGTGAAACGGAAGCG GCGAGCCTTAGTTTGGACAGG
Ctgf CTGF NM_010217 PrimerBank: 6753878a1 GGGCCTCTTCTGCGATTTC ATCCAGGCAAGTGCATTGGTA
Acta2 αSMA NM_007392 PrimerBank: 31982518b1 CCCAGACATCAGGGAGTAATGG TCTATCGGATACTTCAGCGTCA
Col1a1 COL1A1 NM_007742 World J. Gastroenterol. 4(12):356, 2012 ATGTTCAGCTTTGTGGACCTC CAGAAAGCACAGCACTCGC
Col1a2 COL1A2 NM_007743 Am. J. Pathol. 176(6):2743, 2010 GGTGAGCCTGGTCAAACGG ACTGTGTCCTTTCACGCCTTT
Serpinh1 HSP47 NM_009825 PrimerBank: 6753304a1 GCCGAGGTGAAGAAACCCC CATCGCCTGATATAGGCTGAAG
Mmp2 MMP2 NM_008610 PrimerBank: 47271505b1 GATGTCGCCCCTAAAACAGAC CAGCCATAGAAAGTGTTCAGGT
Mmp9 MMP9 NM_013599 PrimerBank: 31560795b2 GGACCCGAAGCGGACATTG GAAGGGATACCCGTCTCCGT
Mmp13 MMP13 NM_008607 PrimerBank: 291463259b1 TGTTTGCAGAGCACTACTTGAA CAGTCACCTCTAAGCCAAAGAAA
Timp1 TIMP1 NM_011593 PrimerBank: 6755795a1 GCAACTCGGACCTGGTCATAA CGGCCCGTGATGAGAAACT