Skip to main content

Table 3 Primers used in quantitative RT-PCR

From: L59 TGF-β LAP degradation products serve as a promising blood biomarker for liver fibrogenesis in mice

Target Primer sequences
5′-primer 3′-primer
human GAPDH GGAGTCAACGGATTTGGT AAGATGGTGATGGGATTTCCA
human Col Iα1 ACGAAGACATCCCACCAATC AGATCACGTCATCGCACAAC
mouse GAPDH AACTTTGGCATTGTGGAAGG ACACATTGGGGGTAGGAACA
mouse αSMA ACAGCCCTCGCACCCA GCCACCGATCCAGACAGAGT