Skip to main content

Table 2 Primers used for PCR

From: Circulating CO3-610, a degradation product of collagen III, closely reflects liver collagen and portal pressure in rats with fibrosis

Primer name Sequence 5'→3'
Col1α2 Left AGACCTGGCGAGAGAGGAGT
  Right ATCCAGACCGTTGTGTCCTC
Col3α1 Left TCCCCTGGAATCTGTGAATC
  Right TGAGTCGAATTGGGGAGAAT
Timp1 Left CATGGAGAGCCTCTGTGGAT
  Right TGTGCAAATTTCCGTTCCTT
Timp2 Left GACAAGGACATCGAATTTATCTACAC
  Right CCATCTCCTTCCGCCTTC
Mmp2 Left GCGCTTTTCTCGAATCCAT
  Right GGGTATCCATCTCCATGCTC
Mmp9 Left CCTGAAAACCTCCAACCTCA
  Right GAGTGTAACCATAGCGGTACAGG
Hprt1 Left GACCGGTTCTGTCATGTCG
  Right ACCTGGTTCATCATCACTAATCAC