Skip to main content

Table 1 Primer and Probe sequences for real-time RT-PCR

From: TLR9-induced interferon β is associated with protection from gammaherpesvirus-induced exacerbation of lung fibrosis

Gene Oligo Sequence 5'→3'
Glycoprotein Ba Forward CGCTCATTACGGCCCAAA
  Reverse ACCACGCCCTGGACAACTC
  Probe TTGCCTATGACAAGCTGACCACCA
β-actin Forward CCGTGAAAAGATGACCCAGATC
  Reverse CACAGCCTGGATGGCTACGT
  Probe TTTGAGACCTTCAACACCCCCAGCCA
Interferon-β Forward TGACGGAGAAGATGCAGAAGAG
  Reverse TGGAGTTCATCCAGGAGACGTA
  Probe TGCCTTTGCCATCCAAGAGATGCTC
Toll-like receptor-9 Forward GAGTACTTGATGTGGGTGGGAATT
  Reverse GCCACATTCTATACAGGGATTGG
  Probe CCGTCGCTGCGACCATGCC
DNA polymerase Forward ACAGCAGCTGGCCATAAAGG
  Reverse TCCTGCCCTGGAAAGTGATG
  Probe CCTCTGGAATGTTGCCTTGCCTCCA
  1. aGamma herpesvirus 68 open-reading frame 8.