Skip to main content

Table 1 Primers used for qRT-PCR

From: Thrombospondin 1 in hypoxia-conditioned media blocks the growth of human microvascular endothelial cells and is increased in systemic sclerosis tissues

Gene Primer Sequence
THBS1 Forward
Reverse
CTGACCTGAAATACGAATGTAGAGA
TTTCTCAAGCCCATAGTTCCAGAAG
TUBB Forward
Reverse
ACATACCTTGAGGCGAGCAA
TCACTGATCACCTCCCAGAA
SDHA Forward
Reverse
AGAAGCCCTTTGAGGAGCA
CGATCACGGGTCTATATTCCAGA