Skip to main content

Table 1 Primers sequences used in quantitative polymerase chain reaction.

From: Insulin-like growth factor binding protein 5 enhances survival of LX2 human hepatic stellate cells

Gene Symbol Primers (5'→3')
Insulin-like growth factor binding protein 5 IGFBP5 F: GTCACTCCCCAGAGAAGCTG
   R: CCCCTGCTTAGATTGCCATA
Insulin-like growth factor 1 receptor IGF1R F: GGTTGAGGTGAGAGGTTTGC
   R: CAAATTGGCCATGTTATTACCTT
Acidic ribosomal phosphoprotein P0 36B4 F: AGGCGTCCTCGTGGAAGTGA
   R: GCGGATCTGCTGCATCTGCT
Matrix metallopeptidase 1 MMP1 F: AGCTAGCTCAGGATGACATTGATG
   R: CTCCCCGAATCGTAGTTATAGCAT
TIMP metallopeptidase inhibitor 1 TIMP1 F: CACCCACAGACGGCCTTCT
   R: TCTGGTGTCCCCACGAACTT
Collagen, type I, alpha 1 COL1A1 F: GGCGGCCAGGGCTCCGAC
   R: AATTCCTGGTCTGGGGCACC
B-cell CLL/lymphoma 2 BCL2 F: GTTGGTGGGGTCATGTGTGTGGAGAG
   R: TAGCTGATTCGACGTTTTGCCTGA