Skip to main content

Table 1 Primer sequences used for quantitative real-time RT-PCR.

From: Investigation of Toll-like receptors in the pathogenesis of fibrotic and granulomatous disorders: a bronchoalveolar lavage study

Gene

Primer pair Sequence (5'-3')

Annealing

temperature

TLR-2

For: GGGTTGAAGCACTGGACAAT

55°C

 

Rev: TTCTTCCTTGGAGAGGCTGA

 

TLR-3

For: ACACCATCTATTAAAAGACCCATTAT

62°C

 

Rev: TCCAGATTTTGTTCAATAGCTTGTT

 

TLR-4

For: GGTCACCTTTTCTTGATTCCA

55°C

 

Rev: TCAGAGGTCCATCAAACATCAC

 

TLR-7

For: GCTATCAGATTCAAAAACAACAGAA

55°C

 

Rev: CACAAACACCTTTGTAGATCACTTCT

 

TLR-8

For: GGCTTTCTTTCTGAAGTCAGTAGTCT

58°C

 

Rev: TTTCCGTGTAGTTCCAACATAGATAA

 

TLR-9

For: CTGAGTGAGAACTTCCTCTACAAATG

58°C

 

Rev: TCTTTTGGTAATTGAAGGACAGGTTA

 

β-Actin

For: CGGCATCGTCACCAACTG

60°C

 

Rev: GGCACACGCAGCTCATTG