Skip to main content

Table 1 Primer sequences used for quantitative real-time RT-PCR.

From: Investigation of Toll-like receptors in the pathogenesis of fibrotic and granulomatous disorders: a bronchoalveolar lavage study

Gene Primer pair Sequence (5'-3') Annealing
temperature
TLR-2 For: GGGTTGAAGCACTGGACAAT 55°C
  Rev: TTCTTCCTTGGAGAGGCTGA  
TLR-3 For: ACACCATCTATTAAAAGACCCATTAT 62°C
  Rev: TCCAGATTTTGTTCAATAGCTTGTT  
TLR-4 For: GGTCACCTTTTCTTGATTCCA 55°C
  Rev: TCAGAGGTCCATCAAACATCAC  
TLR-7 For: GCTATCAGATTCAAAAACAACAGAA 55°C
  Rev: CACAAACACCTTTGTAGATCACTTCT  
TLR-8 For: GGCTTTCTTTCTGAAGTCAGTAGTCT 58°C
  Rev: TTTCCGTGTAGTTCCAACATAGATAA  
TLR-9 For: CTGAGTGAGAACTTCCTCTACAAATG 58°C
  Rev: TCTTTTGGTAATTGAAGGACAGGTTA  
β-Actin For: CGGCATCGTCACCAACTG 60°C
  Rev: GGCACACGCAGCTCATTG