Skip to main content

Table 1 Sequences used for real-time quantitative polymerase chain reaction

From: Epithelial-mesenchymal transition in primary human bronchial epithelial cells is Smad-dependent and enhanced by fibronectin and TNF-α

Gene Forward primer (5'-3') Reverse primer (5'-3') Probe
Collagen I TGGCCTCGGAGGAAACTTT TCCGGTTGATTTCTCATCATAGC CCCCAGCTGTCTTAT
MMP-2 CGTCTGTCCCAGGATGACATC TGTCAGGAGAGGCCCCATAG 6FAM-AGGGCATTCAGGAGC
MMP-9 TGGGCAGATTCCAAACCTTT TCTTCCGAGTAGTTTTGGATCCA 6-FAM-CCACCACAACATCACCTA
E-cadherin Pre-mixed primers and probe (Applied Biosystems, CA, USA)   
GAPDH Pre-mixed primers and probe (Applied Biosystems)   
  1. MMP, matrix metalloprotease; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.